GENE INFORMATION FOR SPU_018833



Identification
    ID: SPU_018833
    Common Name: Sp-Sumo
    Synonyms: Small ubiquitin-related modifier precursor, ubiquitin-like protein SMT3
    Gene Model Check by: manual annotation
    Ortholog/Homolog:  Likely ortholog of SUMO-3
Expression
    Not Available
Functional Category
    Class Sub-Class Annotation Type
    Hydrolase Hydrolase electronic annotation
Gene Ontology
Sequence

    Gene Model Evidence CDS Exons Peptide All Sequences
    SPU_018833.1 GLEAN prediction 267bp N/A 88aa

    SPU_018833.2 (1) GLEAN prediction N/A 2635bp N/A

    SPU_018833.3a (2) RNAseq Transcriptome (WHL22.195956) N/A 2803bp 51aa

     

    +  Footnotes


    Gbrowse V3.1

Reagents

    WMISH Primers (Reference: 27424271)

      Forward: 5'-ATGCGTTTAGAAGTGAAGCCAAGTAATG-3'
      Reverse: 5'-ACCTACATGTACAATACATGTCAATGAGTTAG-3'

    Translation Block Morpholino (Reference: 27424271)

      ACTTCCTTGTGTTCAGTGGTCATGA

Comment
    Not Available
References